View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1740_low_160 (Length: 235)
Name: NF1740_low_160
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1740_low_160 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 19074063 - 19073853
Alignment:
| Q |
1 |
ttgaactcaattaaatgttacatatactttaaatgagattggtctcacaaattattcagtttcnnnnnnnnnnnnntattccaacttaacactgtcaatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19074063 |
ttgaactcaattaaatgttacatatactttaaatgagattggtctcacaaattattcagtttcaaaaaaataaaaatattccaacttaacactgtcaatc |
19073964 |
T |
|
| Q |
101 |
attaaatcattaacactgtctcaaaaattattgtaaaagataagaagtgggtgcagataaaaagaaatctaagattattgttcttggtcgtgttctatgt |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
19073963 |
attaa--------cactgtctcaaaaattattgtaaaagataagaagtgggtgcagataaaaa-aaatctaagattattgttcttggtcgtgttctatgt |
19073873 |
T |
|
| Q |
201 |
gttcttggtgagttcttatg |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
19073872 |
gttcttggtgagttcttatg |
19073853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University