View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1740_low_164 (Length: 234)
Name: NF1740_low_164
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1740_low_164 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 38522307 - 38522069
Alignment:
| Q |
1 |
ttgaaactcattaaagttagtgtcttttggagttattcacactcttctaagttctaggagagagatctagacattttagccagttaggttgtcnnnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38522307 |
ttgaaactcattaaagttagtgtcttttggagttattcacactcttctaagttctaggagagagatctagacattttagccagttgggttgtcaaaaaaa |
38522208 |
T |
 |
| Q |
101 |
ccaaacnnnnnnnn----ctgggtttgtggtgtttgagtaattgagtgtgagtgcgaggttcaataattttcatcaaggtttactaatttagtgaccctt |
196 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38522207 |
ccaaacttttttttttttctgggtttgtggtgtttgagtaattgagtgtgagtgtgaggttcaataattttcatcaaggtttactaatttagtgaccctt |
38522108 |
T |
 |
| Q |
197 |
tgaggaaaaaatc-gaagggtatctttattttgttgaat |
234 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38522107 |
tgaggaaaaaatcaaaagggtatctttattttgttgaat |
38522069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University