View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1740_low_171 (Length: 225)

Name: NF1740_low_171
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1740_low_171
NF1740_low_171
[»] chr8 (1 HSPs)
chr8 (46-87)||(4322509-4322551)
[»] chr2 (1 HSPs)
chr2 (49-87)||(5558755-5558793)
[»] chr6 (1 HSPs)
chr6 (49-107)||(24608308-24608368)


Alignment Details
Target: chr8 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 46 - 87
Target Start/End: Complemental strand, 4322551 - 4322509
Alignment:
46 caaggccggccatgagggg-tgcaaacagctctattgagctgg 87  Q
    ||||||||||||||||||| |||||||||||||||||||||||    
4322551 caaggccggccatgagggggtgcaaacagctctattgagctgg 4322509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 49 - 87
Target Start/End: Complemental strand, 5558793 - 5558755
Alignment:
49 ggccggccatgaggggtgcaaacagctctattgagctgg 87  Q
    |||||| ||||||||||||||||||||||||||||||||    
5558793 ggccgggcatgaggggtgcaaacagctctattgagctgg 5558755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 49 - 107
Target Start/End: Complemental strand, 24608368 - 24608308
Alignment:
49 ggccggccatgagggg--tgcaaacagctctattgagctggacatcaaaaattttgaggcc 107  Q
    ||||||||||||||||  |||||||||||||| |||||||| | || ||||||||| ||||    
24608368 ggccggccatgaggggggtgcaaacagctctactgagctgggcctccaaaattttggggcc 24608308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University