View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1740_low_176 (Length: 214)
Name: NF1740_low_176
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1740_low_176 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 17 - 116
Target Start/End: Original strand, 7338377 - 7338477
Alignment:
| Q |
17 |
gaacaacacaaaaattgcaaaatttccttctataaaggaccaataacaatataaaggaccaataac-aaaagtggaatcataaaatgaggaataactcct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
7338377 |
gaacaacacaaaaattgcaaaatttccttctataaaggaccaataacaatataaaggaccaataacaaaaagtggaattataaaatgaggaataactcct |
7338476 |
T |
 |
| Q |
116 |
t |
116 |
Q |
| |
|
| |
|
|
| T |
7338477 |
t |
7338477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University