View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1740_low_178 (Length: 209)
Name: NF1740_low_178
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1740_low_178 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 16 - 197
Target Start/End: Complemental strand, 50505291 - 50505110
Alignment:
| Q |
16 |
ctttgtaccagatctttggtttttatatgcatggttttgactaatttttctcgttctccagcttccacggttggagcatgaattgttacattgagagttg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
50505291 |
ctttgtaccagatctttggtttttatatgcatggttttgactaatttttctcgttctccagcttccacggttggagcatgaattgttactttgagagttg |
50505192 |
T |
 |
| Q |
116 |
catgctttatgtattgaatgtgcacgtaccaaaatgactaccagttacgttctcagcaagtagtgtcgtatgatattcttcg |
197 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
50505191 |
catgctttatgtattgaatgtgcatgtaccaaaatgactaccagttacgttctcagcaagtagtgtcgtatgatatttttcg |
50505110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University