View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1740_low_57 (Length: 404)
Name: NF1740_low_57
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1740_low_57 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 1e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 1e-94
Query Start/End: Original strand, 79 - 339
Target Start/End: Original strand, 45037119 - 45037394
Alignment:
| Q |
79 |
catcattcttatcgtcttagttgtgaggataagaagaaacatgaaccttatcttaaaaaagatgatgtttgtagttgctggtggttttgactattttaaa |
178 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |||||||| || |
|
|
| T |
45037119 |
catcattcttatcgtcttagttgtgag-ataagaagaaacatgaaccttatcttaaaaaagatgatgtttgtagttgttggtgtttttaactattttcaa |
45037217 |
T |
|
| Q |
179 |
ataagtgttaatgacagaccacgtattaaaagtgtttaatgtagaatgttgcatctacaagctcatcatgtgcatcctttcttagctttgactgagtttc |
278 |
Q |
| |
|
|||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
45037218 |
ataattgttaatgacaaaccatgtattaaaagtgtttaatgtagaatgttgcatctacaagctcatcatttgcatcctttcttagctttgaccgagtttc |
45037317 |
T |
|
| Q |
279 |
cattgaagtaat----------------ttcattttgagtctcttcaaaatggcagcatatttttgatgcaataata |
339 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45037318 |
cattggagtaattgctggattgcagctattcattttgagtctcttcaaaatggcagcatatttttgatgcaataata |
45037394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University