View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1740_low_64 (Length: 373)
Name: NF1740_low_64
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1740_low_64 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 300; Significance: 1e-168; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 300; E-Value: 1e-168
Query Start/End: Original strand, 19 - 351
Target Start/End: Original strand, 21466834 - 21467166
Alignment:
| Q |
19 |
atttctggttcgataccggcttcaatttcgaatcttacaaatttgatacagctgcagttagatacaaatgagatatcaggtttgattccagttgagattg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21466834 |
atttctggttcgataccggcttcaatttcgaatcttacaaatttgatacagttgcagttagatacaaatgagatatcaggtttgattccagttgagattg |
21466933 |
T |
|
| Q |
119 |
gaaagttgacgaagctagcggnnnnnnncgcttggcagaacaaacttgaaggtagaattccatcagagttaggagattgtgtaagccttgaggctttgga |
218 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21466934 |
gaaagttgacgaagctgacggtttttttcgcttggcagaacaaacttgaaggtagaattccatcagagttaggagattgtgtaagccttgaggctttgga |
21467033 |
T |
|
| Q |
219 |
tttgtcttataattcactcagtgatagtttaccttcaggtctttttaagcttcaaaacttaacaaagcttttgttgatttctaatgatatctctggctct |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21467034 |
tttgtcttataattcactcagtgatagtttaccttcaggtctttttaagcttcaaaacttaacaaagcttttgttgatttctaatgatatctctggctct |
21467133 |
T |
|
| Q |
319 |
attcctcatgagattggtaactgtagttctctg |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
21467134 |
attcctcatgagattggtaactgtagttctctg |
21467166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University