View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1740_low_99 (Length: 314)
Name: NF1740_low_99
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1740_low_99 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 24 - 299
Target Start/End: Original strand, 17594303 - 17594578
Alignment:
| Q |
24 |
tcaacaaccctcatagttgactcataacactcaaacccaatattacactcaacaatctcatacttaatactcaagtcaacatcatcaacggctaccaatc |
123 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17594303 |
tcaacaaccctcatagttgactcataatactcaaacccaatattacactccacgatctcatacttaatactcaagtcaacatcatcaacggctaccaatc |
17594402 |
T |
|
| Q |
124 |
tctcctttgaccagctcacttcttgtgatccgtctgatgggagggaggatccagcacagtaacgtatgcatcccacctcaccgttggatccgtggatacc |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17594403 |
tctcctttgaccagctcacttcttgtgatccgtctgatgggagggagaatccagcacagtaacgtatgcatcccacctcaccgttggatccgtggatacc |
17594502 |
T |
|
| Q |
224 |
gtaacatgtggcgaggttagggaagcgtttgtggagattgaaaaagtctttgataagtggccatgcttgttgtttt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
17594503 |
gtaacatgtggcgaggttagggaagcgtttgtggagattgaaaaagtctttgatgagtggccatgcttgttgtttt |
17594578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University