View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1741-Insertion-2 (Length: 122)
Name: NF1741-Insertion-2
Description: NF1741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1741-Insertion-2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 68; Significance: 8e-31; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 68; E-Value: 8e-31
Query Start/End: Original strand, 31 - 118
Target Start/End: Original strand, 2928489 - 2928576
Alignment:
| Q |
31 |
caactagtctgtcaatctctggtgtactgtttcggcagtttttcagtttcttagatttgtgtattggagctgttctattgcgtttttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
2928489 |
caactagtctgtcaatctctggtgtactgtttgggcggtttttcagtttcttagatttgtgtattggagttgttctattttgtttttc |
2928576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.0000000000006
Query Start/End: Original strand, 77 - 118
Target Start/End: Complemental strand, 3002773 - 3002732
Alignment:
| Q |
77 |
tttcttagatttgtgtattggagctgttctattgcgtttttc |
118 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3002773 |
tttcttatatttgtgtattggagctgttctattgcgtttttc |
3002732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 70 - 110
Target Start/End: Complemental strand, 37200292 - 37200252
Alignment:
| Q |
70 |
ttttcagtttcttagatttgtgtattggagctgttctattg |
110 |
Q |
| |
|
||||||||||||||| |||||||||||| |||| ||||||| |
|
|
| T |
37200292 |
ttttcagtttcttagttttgtgtattggggctgctctattg |
37200252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University