View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1741-Insertion-5 (Length: 296)
Name: NF1741-Insertion-5
Description: NF1741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1741-Insertion-5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 8 - 295
Target Start/End: Original strand, 40050896 - 40051192
Alignment:
| Q |
8 |
cggataagggtggtgaatccgccggcttttttgaggattcggataatatctgttggggctgatgatggtgatggtgctggtgattcagatgctgaattta |
107 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40050896 |
cggataagggtggtgaatccaccggcttttttgaggattcggataatatctgttggggctgatgatggtgatggtgctggtgattcagatgctgaattta |
40050995 |
T |
|
| Q |
108 |
tggtggtgggatagaagaggactattaggagaagtgagagtgtgaagagaggatagtt---------catcttgagtttgttgaaaggggagaagagaat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40050996 |
tggtggtgggatagaagaggactattaggagaagtgagagtgtgaagagaggatagttcatctttaccatcttgagtttgttgaaaggggagaagagaat |
40051095 |
T |
|
| Q |
199 |
ggagaagtggaccttgaagtgggaatgagggagtgagtgatcaaatttattgaggattcaaaggggttatcttaaaattaggtggaatgtttaatta |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40051096 |
ggagaagtggaccttgaagtgggaatgagggagtgagtgatcaaatttattgaggattcaaaggggttatcttaaaattaggtggaatgtttaatta |
40051192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University