View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17410_high_5 (Length: 227)
Name: NF17410_high_5
Description: NF17410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17410_high_5 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 11 - 227
Target Start/End: Original strand, 31762044 - 31762263
Alignment:
| Q |
11 |
ctattatttttcactatgtagtttgaatttgtgatgataaa--gtgcatcaataacatctctaaagtataacagacaatattaatattattatattgctc |
108 |
Q |
| |
|
||||||||||||| | ||||||||| ||||||||||||||| || ||| ||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
31762044 |
ctattatttttcagtgtgtagtttgcatttgtgatgataaaaagtacatgaataacatctctaaaatataacagacaatattaatattattttattgctc |
31762143 |
T |
|
| Q |
109 |
tacttcatttaaatataaatataaatttatgatgtcttgacc-nnnnnnnnnnnnnnnnnttaaatttacgatgttatagttgtatataaattttagatg |
207 |
Q |
| |
|
||||||||| |||| ||||| ||| |||| ||||| |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31762144 |
tacttcattcaaatctaaatttaagtttacgatgttttgaccaaaacaaaataaaagaaattaaatttacgatgttatagttgtatataaattttagatg |
31762243 |
T |
|
| Q |
208 |
atgtttatcactttgtctac |
227 |
Q |
| |
|
|||||||||||||| ||||| |
|
|
| T |
31762244 |
atgtttatcactttatctac |
31762263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University