View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17411_low_4 (Length: 306)
Name: NF17411_low_4
Description: NF17411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17411_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 1 - 294
Target Start/End: Complemental strand, 37068643 - 37068350
Alignment:
| Q |
1 |
ctaatatgaaactttccattctgttttggagtgatatagaattgcttttgtatttattaatcatgcaagtccggactccacaattttttctttgcatata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37068643 |
ctaatatgaaactttccattctgttttggagtgatatagaattgcttttgtatttattaatcatgcaagtccggactccacaattttttctttgcatata |
37068544 |
T |
|
| Q |
101 |
tattttactagcacaaaagtaaaataaaagtgagaatgaaaatatgacaggggaaaagtgaaaactagtacacttaacatagtggaaacatgtgtaaaaa |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37068543 |
tattttactagcataaaagtaaaataaaagtgagaatgaaaatatgacaggggaaaagtgaaaactagtacacttaacatagtggaaacatgtgtaaaaa |
37068444 |
T |
|
| Q |
201 |
tatctcttattttcttaaacttcacttgatatctctcttgaagtagggctatgatttatgaacctagatatgcctatttcagaacaagtataat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37068443 |
tatctcttattttcttaaacttcacttgatatctctcttgaagtagggctatgatttatgaacctagatatgcctatttcagaacaagtataat |
37068350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University