View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17411_low_6 (Length: 218)
Name: NF17411_low_6
Description: NF17411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17411_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 17 - 197
Target Start/End: Original strand, 35228498 - 35228678
Alignment:
| Q |
17 |
cataaccaccattgcatccatcagttgtattagttttcacacaatccactagctcttgctcagagagtgatactaatcttcctgtggttatttgatgaat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35228498 |
cataaccaccattgcatccatcagttgtattagttttgacacaatccactagctcttgctcagagagtgatactaatcttcctgtggttatttgatgaat |
35228597 |
T |
|
| Q |
117 |
accttctattgcagccacaattgcaaatgcccaacaactacctataaacaagaatcaacatcatcttaattagcataattt |
197 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35228598 |
accttctattgcagccacagttgcaaatgcccaacaactacctataaacaagaatcaacatcatcttaattagcataattt |
35228678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 97 - 162
Target Start/End: Original strand, 31176914 - 31176979
Alignment:
| Q |
97 |
cctgtggttatttgatgaataccttctattgcagccacaattgcaaatgcccaacaactacctata |
162 |
Q |
| |
|
||||| |||||||| || ||||| ||||| | ||||||| ||| |||||||||||||||||||||| |
|
|
| T |
31176914 |
cctgttgttatttggtggataccctctatggaagccacagttgaaaatgcccaacaactacctata |
31176979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 101 - 154
Target Start/End: Complemental strand, 29746586 - 29746533
Alignment:
| Q |
101 |
tggttatttgatgaataccttctattgcagccacaattgcaaatgcccaacaac |
154 |
Q |
| |
|
|||||||||| || |||||||||||||||||||| | | |||||||||||||| |
|
|
| T |
29746586 |
tggttatttgttggataccttctattgcagccaccgtagaaaatgcccaacaac |
29746533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University