View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17411_low_7 (Length: 217)
Name: NF17411_low_7
Description: NF17411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17411_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 137 - 198
Target Start/End: Original strand, 22234592 - 22234653
Alignment:
| Q |
137 |
gaattatggcatgcttgtgctggtcctcttacctcacttcctatgaaaggaaatgttgtggt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
22234592 |
gaattatggcatgcttgtgctggtcctcttacctcacttcctaagaaaggaaatgttgtggt |
22234653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 13 - 66
Target Start/End: Original strand, 22234468 - 22234521
Alignment:
| Q |
13 |
tgagatgaatgcattgtgccataaggaatgtgtaaaaggtttttgtttctgtgt |
66 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22234468 |
tgagaagaatgcattgtgccataaggaatgtgaaaaaggtttttgtttctgtgt |
22234521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 137 - 166
Target Start/End: Complemental strand, 7778204 - 7778175
Alignment:
| Q |
137 |
gaattatggcatgcttgtgctggtcctctt |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7778204 |
gaattatggcatgcttgtgctggtcctctt |
7778175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University