View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17412_low_7 (Length: 214)
Name: NF17412_low_7
Description: NF17412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17412_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 32604770 - 32604574
Alignment:
| Q |
1 |
gtgccgtcgtttaatttgtcttgggaatttacnnnnnnngaaaatgttggtttcaacccatgtcaaatctcgtcacacattttgctaacatcattgtacg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| || |
|
|
| T |
32604770 |
gtgccgtcgtttaatttgtcttgggaatttactttttttgaaa-tgttggtttcaacccatgtcaaatctcgtcgcacattttgctaacatcattgtgcg |
32604672 |
T |
|
| Q |
101 |
ttcgaccttccattttctatcgtatgtgcaatctgagccatcttgttttttactcttattgttttcaacactatgaatagaaatctaaggctccatcc |
198 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32604671 |
ttcgaccttccattttctatggtatgtgcaacctgagccatcttgttttttactcttattgttttcaacactatgaatagaaatctaaggctccatcc |
32604574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University