View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17413_high_17 (Length: 289)
Name: NF17413_high_17
Description: NF17413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17413_high_17 |
 |  |
|
| [»] scaffold0013 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0013 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 49617 - 49870
Alignment:
| Q |
1 |
tcaagagaacatgtttcgagtagccacttaagccaccaaactgaaccagatggtcctgtaaattactatgagttgctaaagaagatcataagcaacttga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
49617 |
tcaagagaacatgtttcgagtagccacttaagccaccaaactgaaccagatggtcctgtaaattactatgagttgctaaagaaaatcctaagcaacttga |
49716 |
T |
 |
| Q |
101 |
atccaatgacaaaagttttccataaaaatcacaactaaaaaataaatggtctatatcttcattgataccaccgcggtcaagtttttataagcattgctca |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49717 |
atccaatgacaaaagttttccatcaaaatcacaactaaaaaataaatggtctatatcttcattcataccaccgcagtcaagtttttataagcattgctca |
49816 |
T |
 |
| Q |
201 |
ccatgtaatattgtgaagagtgtaactttc-aattcactggtccgccacatcaa |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
49817 |
ccatgtaatattgtgaagagtgtaactttcaaactcactggtccgccacatcaa |
49870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University