View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17413_high_27 (Length: 221)
Name: NF17413_high_27
Description: NF17413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17413_high_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 20 - 201
Target Start/End: Complemental strand, 12120936 - 12120755
Alignment:
| Q |
20 |
tagaaaacttcaattcaccgaattatataccttctcaaaatcaaacttaaaaagtaatgcaatatttagttaactcggccaagtcaactacctcaatcgc |
119 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
12120936 |
tagaaaatttcaattcaccgaattatataccttctcaaaatcaaccttaaaaagtaatgcaatatttagttaattcggccaagtcaactacctcaatcgc |
12120837 |
T |
 |
| Q |
120 |
caccaacaccctatcaaagagttgtttaccttttaggattatatattgtgatatataatttatcaatctagtccaaatcaat |
201 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12120836 |
caccaacaccccatcaaagagttgtttaccttttaggattatatattgtgatatataatttatcaatctagtccaaatcaat |
12120755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University