View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17413_low_16 (Length: 290)
Name: NF17413_low_16
Description: NF17413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17413_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 18 - 279
Target Start/End: Complemental strand, 11184786 - 11184526
Alignment:
| Q |
18 |
gtctttatgttgtatatgcaggtgagttactgtgtccttttccttcattgtaaagtatggtacataagaagtaaacattcagaaatagcatgctcccttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11184786 |
gtctttatgttgtatatgcaggtgagttactgtgtccttttccttcattgtaaagtatggtacataagaagtaaacattcagaaatagcatgctcccttt |
11184687 |
T |
|
| Q |
118 |
gcaaatcaatcaaattgctttagcatagaatggttggtaccaatataaaaacgaaactgatttattgaagtttgcacctttgttcagaagaatagttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11184686 |
gcaaatcaatcaaattgctttagcataggatagttggtaccaatataaaaacgaaactgatttattgaagtttgcacctttgttcagaagaatagttggt |
11184587 |
T |
|
| Q |
218 |
acttttctctttttcagtgatccttttctcttttctaagcactaaccttcaatgacattctt |
279 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11184586 |
acttttctctttttcagagat-cttttctcttttctaagcactaaccttcaatgacattctt |
11184526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University