View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17413_low_26 (Length: 231)
Name: NF17413_low_26
Description: NF17413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17413_low_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 13 - 216
Target Start/End: Complemental strand, 8531971 - 8531768
Alignment:
| Q |
13 |
aatattatatgaaagatcaacacaataaccatagatacataagatgacaggctgctgtttccgtggttttttaaggatgacagtttggtttttctgtttt |
112 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8531971 |
aatatcatatgaaagatcagcacaataaccatagagacacaagatgacaggctgctgtttcggtggttttttgaggatgacagtttggtttttctgtttt |
8531872 |
T |
 |
| Q |
113 |
agccttctgttagtgctctgcagcattgcagctgttgtttgttggttgaaatttttatgggtggctcctgtgccnnnnnnnccttctgttttcgcttgct |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |||||| | ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8531871 |
agccttctgttagtgctctgcagcattgcagttgttgtttgctggttgcattttttatgggtggctcctgtgcctttttttccttctgttttcgcttgct |
8531772 |
T |
 |
| Q |
213 |
tgct |
216 |
Q |
| |
|
|||| |
|
|
| T |
8531771 |
tgct |
8531768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 13 - 186
Target Start/End: Original strand, 5154296 - 5154469
Alignment:
| Q |
13 |
aatattatatgaaagatcaacacaataaccatagatacataagatgacaggctgctgtttccgtggttttttaaggatgacagtttggtttttctgtttt |
112 |
Q |
| |
|
||||| ||||||||||| | ||||||||||||||| ||| ||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5154296 |
aatatcatatgaaagattagcacaataaccatagagacacaagatgacaggctgctgtttcggtggtttttttaggatgacagtttggtttttctgtttt |
5154395 |
T |
 |
| Q |
113 |
agccttctgttagtgctctgcagcattgcagctgttgtttgttggttgaaatttttatgggtggctcctgtgcc |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| | ||||||||||||||||||||||| |
|
|
| T |
5154396 |
agccttctgttagtgctctgcagcattgcagctgttgtttgctggttgcattttttatgggtggctcctgtgcc |
5154469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University