View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17413_low_30 (Length: 201)
Name: NF17413_low_30
Description: NF17413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17413_low_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 102; Significance: 7e-51; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 13 - 118
Target Start/End: Complemental strand, 11017797 - 11017692
Alignment:
| Q |
13 |
aaaatgatatttataaccgtaattttttaaggtatgttatttgatcaactgttttccaaaaacttatggaacgataaacaatattcaggatattgaaatt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11017797 |
aaaatgatatttataaccgtaattttttaaggtatgttatttgatcaactgttttccgaaaacttatggaacgataaacaatattcaggatattgaaatt |
11017698 |
T |
 |
| Q |
113 |
agaacc |
118 |
Q |
| |
|
|||||| |
|
|
| T |
11017697 |
agaacc |
11017692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 150 - 184
Target Start/End: Complemental strand, 11017659 - 11017625
Alignment:
| Q |
150 |
tgatattgttaaaaggttgttcattaggttgtctt |
184 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
11017659 |
tgatattgttaaaaggttgtttattaggttgtctt |
11017625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University