View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17416_low_1 (Length: 482)
Name: NF17416_low_1
Description: NF17416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17416_low_1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 426; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 426; E-Value: 0
Query Start/End: Original strand, 13 - 464
Target Start/End: Original strand, 4468370 - 4468823
Alignment:
| Q |
13 |
cagatgaataactagagggggaatcatgcattcatgaaatatatgaaaatcaaatagttcataatttagctccaatttttctactttcaaacatcactt- |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4468370 |
cagatgaataactagagggggaatcatgcattcatgaaatatatgaaaatcaaatagttcataatttagctccaatttttctactttcaaacatcactta |
4468469 |
T |
|
| Q |
112 |
tgttatgaactggcataggcctcaaaatcttcgttatgtaaggctaaacacacaggctcaaccatggattctcactatcccgtaacgcctcaatggctag |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4468470 |
tgttatgaactggcataggcctcaaaatcttcgttatgtaaggctaaacacacaggctcaaccatggattctcactatcccgtaacgcctcaatggctag |
4468569 |
T |
|
| Q |
212 |
ctcagttctagattcttgatcatgtgtaacacccccaacag-tagtaatagtcgttggagctgaacactgataaacgtcgtatgtaacgaaccctttgtc |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4468570 |
ctcagttctagattcttgatcatgtgtaacacccccaacggctagtaatagtcgttggagctgaacactgataaacgtagtatgtaacgaaccctttgtc |
4468669 |
T |
|
| Q |
311 |
agtctctaacaactccttgtcagtgcctataaaatacatgcttctttcaccacaaatgcaaggtacacaatttgtcaatttatatccactttctatctca |
410 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4468670 |
aatctctaacaactccttgtcagtgcctataaaatacatgcttctttcaccacaaatgcaaggtacacaatttgtcaatttatatccactttctatctca |
4468769 |
T |
|
| Q |
411 |
tactctttgctcaatcattgacttgaacgtcagagtgactgcaggtactgacct |
464 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4468770 |
tactctttgctcaatcattgacttgaacgtcagagtgactgcaggtactgacct |
4468823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University