View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17418_high_10 (Length: 299)
Name: NF17418_high_10
Description: NF17418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17418_high_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 20 - 285
Target Start/End: Original strand, 30415548 - 30415813
Alignment:
| Q |
20 |
tatcacttccctcaccctttgctcactaaaagtttcttgtgtgacaagaaagatgagtggcctgtaacaatataagagaagcataagtagcacaatgtac |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30415548 |
tatcacttccctcaccctttgctcactaaaagtttcttgtgtgacaagaaagatgagtggcctgtaacaatataagagaagcataagtagcacgatgtac |
30415647 |
T |
|
| Q |
120 |
acatataatgacacccaaacataaaaagtccacttccaatttcgaattaactctttagcccaaggtaaatgggagtttataacaatttcagcttcatata |
219 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30415648 |
acatataatgacacccaaacatagaaagtccacttccaatttcgaattaactctttagcccaaggtaaatgggagtttataacaatttcagcttcatata |
30415747 |
T |
|
| Q |
220 |
gttgtggaagagatgaagttcctgctcttggatgcagggttactcttatagcatttgttctttgat |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30415748 |
gttgtggaagagatgaagttcctgctcttggatgcagggttactcttatagcatttgttctttgat |
30415813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University