View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17418_high_13 (Length: 240)
Name: NF17418_high_13
Description: NF17418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17418_high_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 14513210 - 14512984
Alignment:
| Q |
1 |
gttctctcagtagctattgctgttttcttatttcccactatccagcgccgaatcaaaagagcaaaacaattggtatgttttgttgttgtatattctgann |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14513210 |
gttctctcagtagctattgctgttttcttatttcccactatccagcgccggatcaaaagagcaaaacaattggtatgttttgttgttgtatattctgatt |
14513111 |
T |
 |
| Q |
101 |
nnnnnnaatcattcaatttatggtaatttgacaatttatctccatgtgtgttctgttttaagatataaaca--tgtatgtgtagtttgacgatttttcaa |
198 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
14513110 |
ttatttattcattcaatttatggtaatttgacaatttatctccatgtgtgttctgttttaagatataaacatgtgtgtgtgtagtttgacgatttttcaa |
14513011 |
T |
 |
| Q |
199 |
attttctcttttttattggaatatttt |
225 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
14513010 |
attttctcttttttattggaatatttt |
14512984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University