View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17418_high_17 (Length: 210)
Name: NF17418_high_17
Description: NF17418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17418_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 12 - 192
Target Start/End: Complemental strand, 20332128 - 20331948
Alignment:
| Q |
12 |
ccaacaaaatataaaaacctaacacttatcttcaatcttaagtaaccttgattttagttctaatcaaaaaatttgatttggaatttcatagatgagacta |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20332128 |
ccaacacaatataaaaacctaacacttatcttcaatcttaagtaaccttgattttagttctaatcaaaaaatttgatttggaatttcatagatgagacta |
20332029 |
T |
 |
| Q |
112 |
gagatgaactttgaatttttgagttcttttaacttgattctaaagtgcttcataactttcgattgtgatctacttgatttt |
192 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
20332028 |
gtgatgaactttgaatttttgagttcttttaacttgattctaaagtgcttcataactttttattgtgatctacttgatttt |
20331948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University