View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17418_high_4 (Length: 385)
Name: NF17418_high_4
Description: NF17418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17418_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 350; Significance: 0; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 6 - 367
Target Start/End: Original strand, 29295819 - 29296180
Alignment:
| Q |
6 |
agcagcacagagaccgatcgtttcacagagaggttgaaaaagagattcactatattctttcttgagcgaattaagaagaggttctttgagttgattaagc |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29295819 |
agcagcacaaagaccgatcgtttcacagagaggttgaaaaagagattcactatattctttcttgagcgaattaataagaggttctttgagttgattaagc |
29295918 |
T |
|
| Q |
106 |
atactaggattccatttatcagattttttgaaaatgtgaagaagaatcgaaacagcttcgtttcggatctcgagtttagggtgagtttctagaagtttcg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29295919 |
atactaggattccatttatcagattttttgaaaatgtgaagaagaatcgaaacagcttcgtttcggatctcgagtttagggtgagtttctagaagtttcg |
29296018 |
T |
|
| Q |
206 |
cgagcttgaaagcgaatgcgttagggtaatgatgagcgagggatttgaaaacggtttggaatgaaggatccttggattggatgaagatttggattgtttc |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29296019 |
cgagcttgaaagcgaatgcgttagggtaatgatgagcgagggatttgaaaacggtttggaatgaaggatccttggattggatgaagatttggattgtttc |
29296118 |
T |
|
| Q |
306 |
gagaagagaagagaagtcgttggatcggagaatctttgtgacgtgtggttgaagttcgaagt |
367 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29296119 |
gagaagagaagagaagtcgttggatcggagaatctttgtgacatgtggttgaagttcgaagt |
29296180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 192 - 256
Target Start/End: Original strand, 29333455 - 29333519
Alignment:
| Q |
192 |
ttctagaagtttcgcgagcttgaaagcgaatgcgttagggtaatgatgagcgagggatttgaaaa |
256 |
Q |
| |
|
||||||||| || || || || |||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
29333455 |
ttctagaagctttgcaagtttcaaagcgaatgcgttagggtaatgatgtgcgaatgatttgaaaa |
29333519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University