View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17418_low_18 (Length: 222)
Name: NF17418_low_18
Description: NF17418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17418_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 25 - 187
Target Start/End: Complemental strand, 41448835 - 41448672
Alignment:
| Q |
25 |
tcaaagaaatggccagctggttgagcagtatgcagaagcagtttcacactacatagtgtgtataagttcttaactccaacatcaaaataaatatctggac |
124 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41448835 |
tcaaagaaatggccggctggttgagcaatatgcagaagcagtttcacactacatagtgtgtataagttcttaactccaacatcaaaacaaatatctggac |
41448736 |
T |
 |
| Q |
125 |
ataattgaaccaaagataaatttggcatctttcagtaagaa-gttataaagaaaataagccaat |
187 |
Q |
| |
|
||||| ||||||||||||| ||||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
41448735 |
ataatagaaccaaagataattttgggatcgttcagtaagaatattataaagaaaataagccaat |
41448672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University