View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1741_high_12 (Length: 284)
Name: NF1741_high_12
Description: NF1741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1741_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 9e-73; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 62 - 280
Target Start/End: Complemental strand, 36890374 - 36890157
Alignment:
| Q |
62 |
aaatataaacggaatagctatgtccaagaggtgtccgttcggtggttcaaatttcatctgagttgtaatttgatcattagtgtcactcttattaatcaaa |
161 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
36890374 |
aaatataaacggaatagccatatccaagaggtgtccgttcggtggttcaaatttcatctgagttgtaatttgattatttgtgtcactcttattaatcaaa |
36890275 |
T |
 |
| Q |
162 |
tttcccctctccannnnnnnataaaataattattaattactttcacagttatgtatgttcttatttcannnnnnnnnnaatatcactatatatttttgtt |
261 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36890274 |
tttcccctctccatttttttataaaataattataaattactttcacagttatgtatgttcttatttca-tttttttttaatatcactatatatttttgtt |
36890176 |
T |
 |
| Q |
262 |
ttggtacattcatctcact |
280 |
Q |
| |
|
||||||||||||| ||||| |
|
|
| T |
36890175 |
ttggtacattcatatcact |
36890157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 36890626 - 36890559
Alignment:
| Q |
1 |
aagaataatacaacagaaaaatgaatagagagcaaaatgtaaggataaataaaattgagcgaaatata |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36890626 |
aagaataatacaacagaaaaatgaatagagagcaaaatgtaaggataaataaaattgagcaaaatata |
36890559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 122 - 167
Target Start/End: Original strand, 29824582 - 29824627
Alignment:
| Q |
122 |
agttgtaatttgatcattagtgtcactcttattaatcaaatttccc |
167 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||||||| ||||||||| |
|
|
| T |
29824582 |
agttgtaatttggtcattagtgccactgttattaataaaatttccc |
29824627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University