View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1741_low_17 (Length: 267)
Name: NF1741_low_17
Description: NF1741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1741_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 10 - 251
Target Start/End: Original strand, 6620821 - 6621061
Alignment:
| Q |
10 |
ataatacttgaaattgaaatctaattcaaagaattcaccagaagctgcaacacaagaagtcaaagaaaccttgtgtacagtcataacagcaagaacaact |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6620821 |
ataatacttgaaattgaaatctaattcaaagaattcaccagaagctgcaacacaagaagtcaaagaaaccttgtgtacagtcataacagcaagaacaact |
6620920 |
T |
|
| Q |
110 |
gcatcatcccataatnnnnnnncaaagtcagacaattaatatatgtttggtatcacagtggatgtattgaaatcatagtaagccgtcttgattttgcaaa |
209 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6620921 |
gcatcatcccataat-aaaaaacaaagtcagacaattaatatatgtttggtgtcacagtggatgtattgaaatcataggaagccgtcttgattttgcaaa |
6621019 |
T |
|
| Q |
210 |
agttatacgacgtagtttttgcacattcacagtaatctatat |
251 |
Q |
| |
|
|||||||| | |||||||||||||| |||| ||||||||||| |
|
|
| T |
6621020 |
agttatacaatgtagtttttgcacaatcacggtaatctatat |
6621061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University