View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1741_low_6 (Length: 432)
Name: NF1741_low_6
Description: NF1741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1741_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 132; Significance: 2e-68; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 73 - 204
Target Start/End: Complemental strand, 13246065 - 13245934
Alignment:
| Q |
73 |
tgttgaatatggcgaagaagaagagaaacgagtgacgttgaatgactcggctcagatggataatcttaatgaagactatgaaaggatacaattggtgatg |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13246065 |
tgttgaatatggcgaagaagaagagaaacgagtgacgttgaatgactcggctcagatggataatcttaatgaagactatgaaaggatacaattggtgatg |
13245966 |
T |
 |
| Q |
173 |
aatgagttggttaaattggaaattcagttggc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
13245965 |
aatgagttggttaaattggaaattcagttggc |
13245934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 212 - 276
Target Start/End: Complemental strand, 13245875 - 13245811
Alignment:
| Q |
212 |
gcaagaattgatctcgaggatcgaatgaagtatatacggagttttatgcggatttatctcaagtc |
276 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13245875 |
gcaagcattgatctcgaggatcgaatgaagtatatacggagttttatgcggatttatctcaagtc |
13245811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 12 - 61
Target Start/End: Complemental strand, 13246171 - 13246122
Alignment:
| Q |
12 |
acagattgttgactgaaatctccgttctatatgcaaaggccagagaactc |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13246171 |
acagattgttgactgaaatctccgttctatatgcaaaggccagagaactc |
13246122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 277 - 316
Target Start/End: Complemental strand, 13245680 - 13245641
Alignment:
| Q |
277 |
gttttacgctggcctcaaataagaactcatcatattgtca |
316 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
13245680 |
gttttacgttggcctcgaataagaactcatcatattgtca |
13245641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 357 - 389
Target Start/End: Original strand, 6829518 - 6829550
Alignment:
| Q |
357 |
gtggcaccagtagttcttaatgaggttaacctg |
389 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6829518 |
gtggcaccagtagttcttaatgaggttaacctg |
6829550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 218 - 276
Target Start/End: Complemental strand, 7308638 - 7308580
Alignment:
| Q |
218 |
attgatctcgaggatcgaatgaagtatatacggagttttatgcggatttatctcaagtc |
276 |
Q |
| |
|
|||||||| ||||||||||||| |||| | ||||| ||||| || |||||||||||||| |
|
|
| T |
7308638 |
attgatctggaggatcgaatgacgtatctccggagctttatacgaatttatctcaagtc |
7308580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University