View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17420_high_8 (Length: 362)
Name: NF17420_high_8
Description: NF17420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17420_high_8 |
 |  |
|
| [»] scaffold0041 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0041 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 174 - 346
Target Start/End: Original strand, 45732 - 45904
Alignment:
| Q |
174 |
aaataagaaaaagaaacatatccacctactctagaattgaatatggcttatctcataaaagtaataccaacatgtatgtttaattcacttgcgattaaaa |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45732 |
aaataagaaaaagaaacatatccacctactctagaattgaatatggcttatctcataaaagtaataccaacatgtatgtttaattcacttacgattaaaa |
45831 |
T |
 |
| Q |
274 |
ttgattttggagatgcaaaattgattattggcatgtttggttgttgtcctagaattgattatgccttaagaat |
346 |
Q |
| |
|
|||||||||||||||||||||||||| |||| || ||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
45832 |
ttgattttggagatgcaaaattgatttttggtatatttggttgttgtcttagaattgattatgcttcaagaat |
45904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 10 - 53
Target Start/End: Original strand, 45554 - 45597
Alignment:
| Q |
10 |
attatactcactattatgcatatttttatacttttttaaataag |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45554 |
attatactcactattatgcatatttttatacttttttaaataag |
45597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 145; Significance: 3e-76; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 174 - 346
Target Start/End: Complemental strand, 40904286 - 40904114
Alignment:
| Q |
174 |
aaataagaaaaagaaacatatccacctactctagaattgaatatggcttatctcataaaagtaataccaacatgtatgtttaattcacttgcgattaaaa |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40904286 |
aaataagaaaaagaaacatatccacctactctagaattgaatatggcttatctcataaaagtaataccaacatgtatgtttaattcacttacgattaaaa |
40904187 |
T |
 |
| Q |
274 |
ttgattttggagatgcaaaattgattattggcatgtttggttgttgtcctagaattgattatgccttaagaat |
346 |
Q |
| |
|
|||||||||||||||||||||||||| |||| || ||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
40904186 |
ttgattttggagatgcaaaattgatttttggtatatttggttgttgtcttagaattgattatgcttcaagaat |
40904114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 10 - 53
Target Start/End: Complemental strand, 40904464 - 40904421
Alignment:
| Q |
10 |
attatactcactattatgcatatttttatacttttttaaataag |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40904464 |
attatactcactattatgcatatttttatacttttttaaataag |
40904421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 272 - 316
Target Start/End: Original strand, 12306902 - 12306945
Alignment:
| Q |
272 |
aattgattttggagatgcaaaattgattattggcatgtttggttg |
316 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||| |||||||||||| |
|
|
| T |
12306902 |
aattgattttggaggtgcaaaattgatt-ttgacatgtttggttg |
12306945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 272 - 321
Target Start/End: Complemental strand, 34063203 - 34063155
Alignment:
| Q |
272 |
aattgattttggagatgcaaaattgattattggcatgtttggttgttgtc |
321 |
Q |
| |
|
||||||| |||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
34063203 |
aattgatattggaggagcaaaattgattat-ggcatgtttggttgttgtc |
34063155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University