View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17420_low_11 (Length: 338)
Name: NF17420_low_11
Description: NF17420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17420_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 9 - 325
Target Start/End: Original strand, 9494599 - 9494915
Alignment:
| Q |
9 |
aatatatatgaataaatggaaatcataatctcatactcgatcacagttgcaaagatatgaatatatgtttgatatcatggtgaatatgtagcttttggca |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
9494599 |
aatatatatgaataaatggaaatcataatctcatactcgatcacagttgcaaagatatgaatatatgtttggtatcaaggtgaatatgtagcttttggca |
9494698 |
T |
|
| Q |
109 |
taagcttcaatgtagcttttggaaaatcaatgtgggctaccgtgattccggcaagcatacataccataccatgatatcaaacatataacttgcgatctaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9494699 |
taagcttcaatgtagcttttggaaaatcaatgtgggctaccgtgattccggcaagcatacataccataccatgatatcaaacatataacttgcgatctaa |
9494798 |
T |
|
| Q |
209 |
acttctatagagtactttcnnnnnnntaattacttcattattacatctttaatgtttggattaattaacggtttctttgtgtcatgcagtaccaatacta |
308 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9494799 |
acttctatagagtactttcaaaaaaataattacttcattattacatcttgaatgtttggattaattaacggtttctttgtgtcatgcagtaccaatacta |
9494898 |
T |
|
| Q |
309 |
tcatgtcttggaatttt |
325 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
9494899 |
tcatgtcttggaatttt |
9494915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University