View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17421_high_25 (Length: 256)
Name: NF17421_high_25
Description: NF17421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17421_high_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 23044847 - 23044609
Alignment:
| Q |
1 |
gaatatattcagccgaatcatcaagtttagttaattttctgttatcctcgtgcacaactggatcagaattaacaaaataatgctctatctctcctctgac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23044847 |
gaatatattcagccgaatcatcaagtttagttaattttctgttatcctcgtccacaactggatcagaattaacaaaataatgctctatctctcctctgac |
23044748 |
T |
 |
| Q |
101 |
ctcttctggaattttagatagtttccttgtcagtttattcatcatgacccaaacactgtagaacatcaaaagcaaaaccaacaaatcagaaattgcaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23044747 |
ctcttctggaattttagatagtttccttgtcagtttattcatcatgacccaaacactgtagaacatcaaaagcaaaaccaacaaatcagaaattgcaaaa |
23044648 |
T |
 |
| Q |
201 |
gtgcttcatgtataacttaaatatctaataagtaattta |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23044647 |
gtgcttcatgtataacttaaatatctaataagtaattta |
23044609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 85 - 159
Target Start/End: Complemental strand, 46403101 - 46403027
Alignment:
| Q |
85 |
ctatctctcctctgacctcttctggaattttagatagtttccttgtcagtttattcatcatgacccaaacactgt |
159 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| || || || || || ||||||||||||||||||||||||||| |
|
|
| T |
46403101 |
ctatctctcctctgacttcttccggaattttggacagctttctggtatgtttattcatcatgacccaaacactgt |
46403027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University