View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17421_low_13 (Length: 366)
Name: NF17421_low_13
Description: NF17421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17421_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 319; Significance: 1e-180; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 1 - 347
Target Start/End: Original strand, 34895076 - 34895422
Alignment:
| Q |
1 |
aatgcaagaagggaagccatgaggagaatgttgtgcctagccattgttatgtgaaatttgagagtttttgctattgcttctttttgattttatgagtaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34895076 |
aatgcaagaagggaagccatgaggagaatgttgtgcctggccattgttctgtgaaatttgagagtttttgctattgcttctttttgattttatgagtaat |
34895175 |
T |
|
| Q |
101 |
aaagagggaaagagagtggtatttatagaggatttggggagatgcatgttaggtacgtacgtggaaggggaatatgtaggttttggtgttttcatggtgt |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34895176 |
aaagagggaaagagggtggtatttatagaggatttggggagattcatgttaggtacgtacgtggaaggggaatatgtaggttttggtgttttcatggtgt |
34895275 |
T |
|
| Q |
201 |
ggctatgtttgcttatttgcttgttttatgagttccacgtatcacagtttcatgaacacgggtctagtgatttatttgctacacaacagctaggttgctt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34895276 |
ggctatgtttgcttatttgcttgttttatgagttccacgtatcacagtttcatgaacacgggtctggtgatttatttgctacacaacagctaggttgctt |
34895375 |
T |
|
| Q |
301 |
gatttggattctagttttcacttgcataatagatataaattctagag |
347 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34895376 |
gatttggattgtagttttcccttgcataatagatataaattctagag |
34895422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 1 - 328
Target Start/End: Original strand, 34902592 - 34902920
Alignment:
| Q |
1 |
aatgcaagaagggaagccatgaggagaatgttgtgcctagccattgttatgtgaaatttgagagtttttgctattgcttctttttgattttatgagtaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34902592 |
aatgcaagaagggaagccatgaggagaatgttgtgcctggccattgttatgtgaaatttgagagtttttgctattgcttctttttgattttatgagtaat |
34902691 |
T |
|
| Q |
101 |
aaagagggaaagagagtggtatttatagaggatttggggagatgcatgttaggtacgtacgtggaaggggaatatgtaggttttggtgttttcatggtgt |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34902692 |
aaagagggaaagagggtggtatttatagaggatttggggtgatgcttgttaggtacgtacgtggtaggggaatatgtaggttttggtgttttcatggtgt |
34902791 |
T |
|
| Q |
201 |
ggctatgtttgcttatttgcttgttttatgagttccacgta-tcacagtttcatgaacacgggtctagtgatttatttgctacacaacagctaggttgct |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |||||| ||||||||||||||||||| |||| |
|
|
| T |
34902792 |
ggctatgtttgcttatttgcttgttttatgagttccacgtattgacagtttcatgaacacgggtcagttgatttctttgctacacaacagctagactgct |
34902891 |
T |
|
| Q |
300 |
tgatttggattctagttttcacttgcata |
328 |
Q |
| |
|
|||||||||||||||||||| |||||||| |
|
|
| T |
34902892 |
tgatttggattctagttttcccttgcata |
34902920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 85 - 264
Target Start/End: Original strand, 34908895 - 34909075
Alignment:
| Q |
85 |
tgattttatgagtaataaagagggaaagagagtggtatttatagaggatttggggagatgcatgttaggtacgtacgtggaaggggaatatgta----gg |
180 |
Q |
| |
|
|||||| |||||||| | ||||||| |||| ||||||||||| ||||||||| || | |||||||||||||||| | ||||| ||| || || |
|
|
| T |
34908895 |
tgatttgatgagtaaaatagagggatagagggtggtatttattgaggatttgaggtgttgcatgttaggtacgt----gtaagggaaattggtgaggggg |
34908990 |
T |
|
| Q |
181 |
ttttggtgttttcatggtgtggctatgtttgcttatttgcttgttttatgag-ttccacgtatcacagtttcatgaacacgggtc |
264 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| || |||||||||||| | |||||||||| ||||||||| ||||||||| |
|
|
| T |
34908991 |
ttttggtgttttgatggtgtggctatgtttgcttcttggcttgttttatgggtttccacgtatggaagtttcatgcacacgggtc |
34909075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University