View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17421_low_27 (Length: 250)
Name: NF17421_low_27
Description: NF17421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17421_low_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 37927404 - 37927183
Alignment:
| Q |
18 |
atttatttaatggtaactcattttagttattgagatatatttcatctttaaaaagaaaa-gtattggttcaaagttcaaagaacaataactgattctcca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37927404 |
atttatttaatggtaactcattttagttattgagatatatttcatctttaaaaagaaaaagtattggttcaaagttcaaagaacaataactgattctcca |
37927305 |
T |
|
| Q |
117 |
aatgtacggtagaaattctctagtcgttatgactgtaataataattcagaaacagctgaacttcacatggatggatgaatttcatgtgacacgttgcttc |
216 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37927304 |
aatgtacgatagaaattctctagtcgttatgactgtaataataattcagaaacagctgaacttcacatgcatggatgaatttcatgtgacacgttgcttc |
37927205 |
T |
|
| Q |
217 |
aattctattctagcccctttca |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
37927204 |
aattctattctagcccctttca |
37927183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University