View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17421_low_33 (Length: 235)
Name: NF17421_low_33
Description: NF17421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17421_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 20 - 223
Target Start/End: Original strand, 38556135 - 38556340
Alignment:
| Q |
20 |
caatatatatgatgattcatccaggtgtgatatactccccagaacttccaagaatatgatccatataatggttatgattttcaatcatataaactaaatt |
119 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| ||| ||||||||||| |
|
|
| T |
38556135 |
caatatatatgatgattcatccaagtgtgatatactccccagaacttccaagaatatgatccatataatggatatgattatcaaccatttaaactaaatt |
38556234 |
T |
 |
| Q |
120 |
aattctcaccatagtggatgttatccatctnnnnnnnntgttaaccttcaagtaaattcatatcatattatgtgcgagaagctgatttat--acaatgac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38556235 |
aattctcaccatagtggatgttatccatctaaaaaaaatgttcaccttcaagtaaattcatatcatattatgtgcgagaagctgatttattaacaatgac |
38556334 |
T |
 |
| Q |
218 |
acaggt |
223 |
Q |
| |
|
||||| |
|
|
| T |
38556335 |
ccaggt |
38556340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University