View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17421_low_37 (Length: 201)
Name: NF17421_low_37
Description: NF17421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17421_low_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 32; Significance: 0.000000004; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 10208384 - 10208349
Alignment:
| Q |
1 |
tttttcattaaccttttgttcttctctgcgtgcatc |
36 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10208384 |
tttttcattaaccttctgttcttctctgcgtgcatc |
10208349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 188
Target Start/End: Complemental strand, 10208228 - 10208198
Alignment:
| Q |
158 |
atctatcttagggtgtgaacataagaataat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
10208228 |
atctatcttagggtgtgaacataagaataat |
10208198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 186
Target Start/End: Original strand, 48118606 - 48118634
Alignment:
| Q |
158 |
atctatcttagggtgtgaacataagaata |
186 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
48118606 |
atctatcttagggtgtgaacataagaata |
48118634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University