View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17422_high_20 (Length: 283)
Name: NF17422_high_20
Description: NF17422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17422_high_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 18 - 179
Target Start/End: Complemental strand, 31820901 - 31820740
Alignment:
| Q |
18 |
attggtctatatattttttaattcctataatccatttgcaatatccaagtctatctttttcagacaatacgtgaaagcgatgcaaggagtgatctcaaag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31820901 |
attggtctatatattttttaattcctataatccatttgcaatatctaagtctatctttttcagacaatacgtgaaagcgatgcaaggagtgatctcaaag |
31820802 |
T |
|
| Q |
118 |
tcttcagtttagtgttggtcttagtcagagtgagttgaaagggtgcatgatgttgtggagtt |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31820801 |
tcttcagtttagtgttggtcttagtcagagtgagttgaaagggtgcatgatgttgtggagtt |
31820740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 176 - 283
Target Start/End: Complemental strand, 31820717 - 31820611
Alignment:
| Q |
176 |
agttcttgtctttcagtttcaggttgcatccaaaatttgtgaaaaatcacatacttatgaaattctagaaaatataagcttcttagttttttccggatat |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31820717 |
agttcttgtctttcagtttcaggttgcatccaaaatttgtgaaaaatcacatacttatgaaattctagaaaatataagcttctta-ttttttccggatat |
31820619 |
T |
|
| Q |
276 |
gtatatct |
283 |
Q |
| |
|
|||||||| |
|
|
| T |
31820618 |
gtatatct |
31820611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University