View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17422_high_22 (Length: 274)
Name: NF17422_high_22
Description: NF17422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17422_high_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 20 - 240
Target Start/End: Complemental strand, 13658637 - 13658417
Alignment:
| Q |
20 |
ccttcctcaagctccttcaatagtcctttttcttgtaccatgtttggcctaatcacccacaaaaatgattttttgctattcaataaaccgtgccaaatct |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13658637 |
ccttcctcaagctccttcaatagtcctttttcttgtaccatgtttggcctaatcacccacaaaaatggttttttgctattcaataaaccgtgccaaatct |
13658538 |
T |
 |
| Q |
120 |
caatgatttcttctcccttcattggggtgatgctaccaaagctaacatatacaaccgatttcaacggttgagattcaagccatgtcatgcaagttctatc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13658537 |
caatgatttcttctcccttcattggggtgatgctaccaaagctaacatatacaaccgatttcaacggttgagattcaagccatgtcatgcaagttctatc |
13658438 |
T |
 |
| Q |
220 |
cacttcgaagaaattgctctt |
240 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
13658437 |
cacttcgaagaaattgctctt |
13658417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 20 - 240
Target Start/End: Complemental strand, 13648109 - 13647889
Alignment:
| Q |
20 |
ccttcctcaagctccttcaatagtcctttttcttgtaccatgtttggcctaatcacccacaaaaatgattttttgctattcaataaaccgtgccaaatct |
119 |
Q |
| |
|
|||||||||||||| | |||| |||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
13648109 |
ccttcctcaagctcacttaataatcctttttcttgtaccatgtttggcctaatcacccataaaaactgttttttgctattcaataaaccatgccaaatct |
13648010 |
T |
 |
| Q |
120 |
caatgatttcttctcccttcattggggtgatgctaccaaagctaacatatacaaccgatttcaacggttgagattcaagccatgtcatgcaagttctatc |
219 |
Q |
| |
|
|||| |||||||||| ||||||||| || |||| |||||||||||||||| ||| |||||||| |||||||| |||||||| | |||||| |||||||| |
|
|
| T |
13648009 |
caattatttcttctctcttcattggtgtagtgcttccaaagctaacatatataactgatttcaatggttgagagtcaagccacgccatgcaggttctatc |
13647910 |
T |
 |
| Q |
220 |
cacttcgaagaaattgctctt |
240 |
Q |
| |
|
||||| ||||||||||||||| |
|
|
| T |
13647909 |
cactttgaagaaattgctctt |
13647889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 20 - 235
Target Start/End: Complemental strand, 13653164 - 13652949
Alignment:
| Q |
20 |
ccttcctcaagctccttcaatagtcctttttcttgtaccatgtttggcctaatcacccacaaaaatgattttttgctattcaataaaccgtgccaaatct |
119 |
Q |
| |
|
||||||||||| || || | ||||| ||||||||||||||||||||| |||||||||||||| |||| ||||||||| ||||| ||||||||||||| || |
|
|
| T |
13653164 |
ccttcctcaagttcttttattagtcttttttcttgtaccatgtttggtctaatcacccacaagaatgcttttttgctgttcaacaaaccgtgccaaaact |
13653065 |
T |
 |
| Q |
120 |
caatgatttcttctcccttcattggggtgatgctaccaaagctaacatatacaaccgatttcaacggttgagattcaagccatgtcatgcaagttctatc |
219 |
Q |
| |
|
||| |||||||||| | |||||| ||| |||| |||||||||||||||||||| || ||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
13653064 |
caagtatttcttctctcgtcattgttgtggtgcttccaaagctaacatatacaactgacttcaacggttgagattcgagccatgtcatgcaggttctatc |
13652965 |
T |
 |
| Q |
220 |
cacttcgaagaaattg |
235 |
Q |
| |
|
||||| |||||||||| |
|
|
| T |
13652964 |
cactttgaagaaattg |
13652949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University