View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17422_high_31 (Length: 239)
Name: NF17422_high_31
Description: NF17422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17422_high_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 30395829 - 30395607
Alignment:
| Q |
1 |
ttggagttatatgccatttttgattttattaagaaagtgacacaaaaacggtannnnnnnnnnnnnnnnnnnnnnngctcaactaagaagccaaaatagc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30395829 |
ttggagttatatgccatttttgattttattaagaaagtgacacaaaaacggtatttttctgtttttccacttttttgctcaactaagaagccaaaatagc |
30395730 |
T |
|
| Q |
101 |
atttcaacactcatttgctagaagaaattgtatacagtgtagtaattttcatgcttttgnnnnnnngtgcaaataattttcatgcttttattatgacatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
30395729 |
atttcaacactcatttgctagaagaaattgtatacagtgtagtaactttcatgcttttgtttttttgtgcaaataattttcatgcttttattatgacatt |
30395630 |
T |
|
| Q |
201 |
ggtaatttgtttaaccatcgttg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
30395629 |
ggtaatttgtttaaccatcgttg |
30395607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University