View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17422_high_34 (Length: 209)
Name: NF17422_high_34
Description: NF17422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17422_high_34 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 15 - 180
Target Start/End: Complemental strand, 33658780 - 33658615
Alignment:
| Q |
15 |
taggtgtttcttggatgaatgggtcgtagaagggttatgaaagccgcttcaaagaggcagtgattatcaagctcttgggtaagtccattggttattttga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33658780 |
taggtgtttcttggatgaatgggtcgtagaagggttatgaaagccgcttcaaagaggcagtgattatcaagctcttgggtaagtccattggttattttga |
33658681 |
T |
|
| Q |
115 |
gttgatagataaactgaagttatttggaaaccttcaggtggactatatatcgttgttatatgacat |
180 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33658680 |
gttgatggataaactgaagttatttggaaaccttcaggtggactatatatcgttgttatatgacat |
33658615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University