View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17422_low_16 (Length: 414)
Name: NF17422_low_16
Description: NF17422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17422_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 348; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 348; E-Value: 0
Query Start/End: Original strand, 1 - 396
Target Start/End: Complemental strand, 32229746 - 32229354
Alignment:
| Q |
1 |
atatacgttttgatggttttaaacttgtgaaacttcaagcattgtcgaaaaaactcannnnnnnccttcttgtatttcttaatcttcaacaaatttaagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32229746 |
atatacgttttgatggttttaaacttgtgaaacttcaagcattgtcgaaaaaactcattttttt--ttcttgtatttcttaatcttcaacaaatttaagt |
32229649 |
T |
|
| Q |
101 |
cacatagatcacattttctctaaaacacaacaagtacgtgtcttaatctttcaatttatcatatttgaatattcaagttgtgtatgttgttgattaattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32229648 |
cacatagatcacattttctctaaaacacaacaagtacgtgtcttaatctttcaatttatcatatttgaatattcaagttgtgtatgttgttgattaattt |
32229549 |
T |
|
| Q |
201 |
gatattgttcagggtttgttgatggtacatgaatgattaattgtttgtttctttgtttgtgttgcatgaattgtattattcatatttaacgttgttgatt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32229548 |
gatattgttcagggtttgttgatggtacatgaatgattaattgtttgtttctttgtttgtgttgcatgaattgtattattcatatttaacgttgttgatt |
32229449 |
T |
|
| Q |
301 |
gtgctctaagtattttatgaaaggcttgaatgataatattttttgtcttattctttgttgtagatatcactgatgatgttgataggacgagacttg |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
32229448 |
gtgctctaagtattttatgaaaggcttgaatgataatatttttt-tcttattctttgttgtagatatcactgatgatgttggtagaacgagacttg |
32229354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University