View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17422_low_21 (Length: 318)
Name: NF17422_low_21
Description: NF17422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17422_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 10 - 290
Target Start/End: Original strand, 19931049 - 19931329
Alignment:
| Q |
10 |
tcataggttgtgtctggtgtgcttttgtgatcattagtttgctttgtgatggatgttctgcttttgccatttttcaggaaatgcgggttggattttgttc |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
19931049 |
tcataggttgtgtctggtgtgcttttgtgatcattagtttgctttgtgatggatgttctgcttttaccatttttcaggaaatgcgggttggtttttgttc |
19931148 |
T |
 |
| Q |
110 |
tctaaatacaatattggccttggtcgtttttcaggatcttgcaatcttgtgggcatagcttatgcagttatgcttatttattttgtttgaatatatcatt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19931149 |
tctaaatacaatattggccttggtcgtttttaaggatcttgcaatcttgtgggcatagcttatgcagttatgcttatttattttgtttgaatatatcatt |
19931248 |
T |
 |
| Q |
210 |
ttgctatttgccaaaaataaaattgaagtacaattttctattttccattagtatcacataggtgtgtatgtgtgaatctac |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19931249 |
ttgctatttgccaaaaataaaattgaagtacaattttctattttccattagtatcacataggtgtgtatgtgtgaatctac |
19931329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University