View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17422_low_27 (Length: 276)
Name: NF17422_low_27
Description: NF17422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17422_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 44 - 258
Target Start/End: Original strand, 38515075 - 38515290
Alignment:
| Q |
44 |
taaacatagatggtgagaaacaaaagggaacaaatgaagacaaaatattttcatcacatacttgagaaaaaatattcaaacacagctcaagttgcaatga |
143 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38515075 |
taaacagagatggtgagaaacaaaagggaacaaatgaagacaatatattttcatcacatacttgagaaaaaatattcaaacacagctcaagttgcaatga |
38515174 |
T |
 |
| Q |
144 |
actagtttttaatcatccggcaaaaatagaattta-ttttaatcaaaataaatttgcaaaatttagctaatacaaatttatgtgtggaaatgtcaatcca |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38515175 |
actagtttttaatcatccggcaaaaatagaatttacttttaatcaaaataaatttgcaaaatttagctaatacaaatttatgtgtggaaatgtcaatcca |
38515274 |
T |
 |
| Q |
243 |
aagatccatcctctcc |
258 |
Q |
| |
|
|| || ||| |||||| |
|
|
| T |
38515275 |
aatatacatactctcc |
38515290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 28094134 - 28094085
Alignment:
| Q |
1 |
tgcatttgttggaaatagaggttgctagaataaaaggggcaattaaacat |
50 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
28094134 |
tgcatttgttggaaatagaggttactagaataaaagggtcaattaaacat |
28094085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University