View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17422_low_32 (Length: 255)
Name: NF17422_low_32
Description: NF17422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17422_low_32 |
 | |
|
| [»] scaffold0026 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 22 - 243
Target Start/End: Original strand, 1360963 - 1361184
Alignment:
| Q |
22 |
gagtgtattactcttaaagtatactatcaaggtccgattcccaccggtgcgtagagcttttctccagctctagctttaaatggcaccttacaaatggacg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1360963 |
gagtgtattactcttaaagtatactatcaaggtccgattcccaccggtgcgtagagcttttctccagctctagctttaaatggcaccttacaaatggacg |
1361062 |
T |
|
| Q |
122 |
atgggattggacctctccgattagttggtttttggactggataccgagtttagaaacaaacnnnnnnnnntattgaaaagtccaaagatttaagttcagc |
221 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1361063 |
atgggattggacctctccaattagttggtttttggactggataccgagtttagaaacaaacaaaaaaatatattgaaaagtccaaagatttaagttcagc |
1361162 |
T |
|
| Q |
222 |
actacctgttccatcgcaccta |
243 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
1361163 |
actacctgttccatcgcaccta |
1361184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 116 - 171
Target Start/End: Complemental strand, 43963921 - 43963866
Alignment:
| Q |
116 |
tggacgatgggattggacctctccgattagttggtttttggactggataccgagtt |
171 |
Q |
| |
|
|||||| |||||||||||| ||| ||||||||||| |||| |||||||||||||| |
|
|
| T |
43963921 |
tggacggtgggattggacccctcagattagttggtccttgggctggataccgagtt |
43963866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 123 - 172
Target Start/End: Complemental strand, 97416 - 97367
Alignment:
| Q |
123 |
tgggattggacctctccgattagttggtttttggactggataccgagttt |
172 |
Q |
| |
|
||||||||| |||||| |||||| ||||||||||| ||||||||||||| |
|
|
| T |
97416 |
tgggattggtcctctcgtattagtcggtttttggaccggataccgagttt |
97367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University