View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17423_high_1 (Length: 357)
Name: NF17423_high_1
Description: NF17423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17423_high_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 1 - 349
Target Start/End: Complemental strand, 49642961 - 49642613
Alignment:
| Q |
1 |
gtaaggaagataaacggcgttagcggttttaggatcttccgttaagcatggatattctaacatacgacgatggaaaatgagttcaagcatggatgggtcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49642961 |
gtaaggaagataaacggcgttagcggttttaggatcttccgttaagcatggatattctaacatacgacgatggaaaatgagttcaagcatggatgggtcg |
49642862 |
T |
 |
| Q |
101 |
gttcggtaccaactatgggaacggttatgggttttttgacccaaaccatggtttgctaagtaaggacataaatcgtctaggaatgtgtattctgaacaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49642861 |
gttcggtaccaactatgggaacggttatgggttttttgacccaaaccatggtttgctaagtaaggacataaatcgtctaggaatgtgtattctgaacaat |
49642762 |
T |
 |
| Q |
201 |
ttgagagtagatctaggttgaattttggtggtaattttcttatgtggatccaacgttgttcgcactcattttctgttgttgttgatttaaggtttttatt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49642761 |
ttgagagtagatctaggttgaattttggtggtaattttcttatgtggatccaacgttgttcgcactcattttctgttgttgttgatttaaggtttttatt |
49642662 |
T |
 |
| Q |
301 |
ttcttcggatttggttggattcattaggaggagtaagatagtgatgatg |
349 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
49642661 |
ttcttcggatttggttggattcaagaggaggaggaagatagtgatgatg |
49642613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 32 - 135
Target Start/End: Original strand, 6623170 - 6623275
Alignment:
| Q |
32 |
ggatcttccgttaagcatgg--atattct-aacatacgacgatggaaaatgagttcaagcatggatgggtcggttcggtaccaactatgggaacggttat |
128 |
Q |
| |
|
||||||| ||||||||||| ||||||| |||||||| ||| ||| ||||||||||||||| |||||||| || || ||||||||||||| ||||| |
|
|
| T |
6623170 |
ggatcttttgttaagcatggggatattcttaacatacggggattgaatatgagttcaagcatgtatgggtcgatt-tgtgtcaactatgggaactgttat |
6623268 |
T |
 |
| Q |
129 |
gggtttt |
135 |
Q |
| |
|
||||||| |
|
|
| T |
6623269 |
gggtttt |
6623275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University