View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17424_low_11 (Length: 355)
Name: NF17424_low_11
Description: NF17424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17424_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 62 - 340
Target Start/End: Original strand, 1252274 - 1252555
Alignment:
| Q |
62 |
taggggcatgcttaaatcggaggtctaagacccgtttattaaaatctagggaaaactacatttacctcccttgaggtttccccttaaacaaacgtttgtt |
161 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1252274 |
taggggcatgcttaaatcggaggtgtaagacccgtttattaaaatctagggaaaactacatttacctcccatgaggtttccccttaaacaaacgtttgtt |
1252373 |
T |
|
| Q |
162 |
acttaaccccggccaccaccaaaaataaattcacagctgaatttccaatgctagnnnnnnnnttaagatgttggtttgtcaaaagagaggttctataaca |
261 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1252374 |
acttaaccccggccaccaacaaaaataaattcacagctgaatttccaatgctagaacgaaaattacgatgttggtttgtcaaaagagaggttctataaca |
1252473 |
T |
|
| Q |
262 |
tagatttctcatctttcacatagttttctggatctgt---cttcgtcagcttttcgattacgattttctctctcggatctgt |
340 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1252474 |
tagatttctcatgtttcacatagttttctggatctgtcgacttcgtcagcttttcgattacgattttctctctcggatctgt |
1252555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 18 - 63
Target Start/End: Original strand, 1251739 - 1251784
Alignment:
| Q |
18 |
aatgtagtccttttatgctccatacagtcttagagaaataccatta |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1251739 |
aatgtagtccttttatgctccatacagtcttagagaaataccatta |
1251784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 112 - 140
Target Start/End: Original strand, 50135031 - 50135059
Alignment:
| Q |
112 |
gaaaactacatttacctcccttgaggttt |
140 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
50135031 |
gaaaactacatttacctcccttgaggttt |
50135059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University