View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17424_low_18 (Length: 328)
Name: NF17424_low_18
Description: NF17424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17424_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 3e-85; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 15 - 240
Target Start/End: Original strand, 36540811 - 36541034
Alignment:
| Q |
15 |
aagacgaattgttcgtgataatttgattcttaaatggaacaatattttgtaagaatttacttaactcaactctgaattactagacctctttctgctagaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36540811 |
aagacgaattgttcgtgataatttgattcttaaatggaacaatattttataagaatttacttaactcaactctgaattactagacctctttccgctagaa |
36540910 |
T |
|
| Q |
115 |
ccagagggtgaacnnnnnnnnnnnnnnngcaagcaagataggtagaaatttattagtttccagcgcctcattgaatgtatgggtatgtactatctattga |
214 |
Q |
| |
|
| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36540911 |
ctagagggtgaac--caaaaaaaaaaaagcaagcaagataggtagaaatttattagtttccagcgcctcatttaatgtatgggtatgtactatctattga |
36541008 |
T |
|
| Q |
215 |
taactacaagagcttgaactaataag |
240 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
36541009 |
taactacaagagcttgaactaataag |
36541034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 245 - 311
Target Start/End: Original strand, 36541412 - 36541478
Alignment:
| Q |
245 |
agaaatagaaaatatctgttgctattcatgttgttacaatagaaatcatcccttagagagaaataat |
311 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36541412 |
agaaatagaaaacatttgttgctattcatgttgttacaatagaaatcatcccttagagagaaataat |
36541478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University