View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17424_low_26 (Length: 245)
Name: NF17424_low_26
Description: NF17424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17424_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 64 - 201
Target Start/End: Complemental strand, 1573839 - 1573702
Alignment:
| Q |
64 |
aacctgtgttgcttgagtaatgttcaatggaacaatagagccaggtgtaacaactacttctgcatattcatcactactcagtcttaagctttctacttct |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1573839 |
aacctgtgttgcttgagtaatgttcaatggaacaacagagccaggtgtaacaactacttctgcatattcatcactactcagtcttaagctttctacttct |
1573740 |
T |
 |
| Q |
164 |
tctactggccattgaagcaaattagttccagtcttctg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1573739 |
tctactggccattgaagcaaattagttccagtcttctg |
1573702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University