View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17424_low_29 (Length: 204)
Name: NF17424_low_29
Description: NF17424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17424_low_29 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 9247284 - 9247487
Alignment:
| Q |
1 |
agttgaattaaacatcttgataaataccttaatcaagccggataaacaatgaacatcgattccatgtggcactacgcctttgtttaactgatctcgaacg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9247284 |
agttgaattaaacatcttgataaataccttaatcaagccggataaacaatgaacatcgattccatgtggcactacgcctttgtttaactgatctcgaacg |
9247383 |
T |
 |
| Q |
101 |
aatgcttcttggctattctcagcagtaatacggaatattccttctgccttcatccatggaaagcatgaaattagaccttaaaattaacatgtaactatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9247384 |
aatgcttcttggctattctcagcagtaatacggaatattccttctgccttcacccatggaaagcatgaaattagaccttaaaattaacatgtaactatta |
9247483 |
T |
 |
| Q |
201 |
taaa |
204 |
Q |
| |
|
|||| |
|
|
| T |
9247484 |
taaa |
9247487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University