View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17426_low_11 (Length: 218)
Name: NF17426_low_11
Description: NF17426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17426_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 14 - 197
Target Start/End: Original strand, 33760503 - 33760686
Alignment:
| Q |
14 |
aagaatatgacccacaagaatcaccttttcattttgtggaattgttgccattagcttcaacaatgtttcagagtattctgaaattgtatcaacatcttca |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33760503 |
aagactatgacccacaagaatcaccttttcattttgcggaattgttgccattagcttcaacaatggttcagagtattctgaaattgtatcaacatcttca |
33760602 |
T |
|
| Q |
114 |
agtttcttcaagttggttccagaagctgaaaggtcaattactgtgaccacatgaccagcagattctaaacgtggcttgatcttg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33760603 |
agtttcttcaagttggttccagaagctgaaaggtcaagtactgtaaccacatgaccagcagattctaaacgtggcttgatcttg |
33760686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University